A Novel Anticancer Effect of Ephedra alata Decne in Breast Cancer Cells.

Cancer is a class of diseases characterized by uncontrolled cell growth. One of the main aims of developing new therapies is to use natural resources to induce apoptosis. LC-ms/ms analysis of a methanolic extract of Ephedra alata (E.A.) allowed the identification of 20 secondary metabolites, including flavonoids, phenolic acids, and proanthocyanidins. Antiproliferative effect was assessed by crystal violet assay. Antimigration effect was tested by wound healing assay and apoptosis induction was determined by annexin binding assays, Hoechst staining, ROS production, and activation of apoptotic proteins. The results indicated that exposure of breast cancer cells to E.A. extract significantly reduced cell viability in a dose and time-dependent manner and inhibited the migration of 4T1 cells at a low dose. Moreover, treatment of cells with E.A. extract induced apoptosis, as it was detected by Annexin V/7 AAD, Hoechst staining, ROS production, and the activation of caspases.Abbreviation:BSAbovine serum albuminDMSOdimethyl sulfoxideEDTAethylenediaminetetraacetic acidLC-ms/msliquid chromatography-mass spectrometryNACN-acetyl-l-cysteinePARPpoly(ADP-ribose) polymerasePMSFphenylmethylsulfonyl fluorideRIPAradioimmunoprecipitation assay bufferROSreactive oxygen speciesRPMIRoswell park memorial instituteSDS-PAGEsodium dodecyl sulfate-polyacrylamide gel electrophoresis.

Development of a Genus-Universal Nucleotide Signature for the Identification and Supervision of Ephedra-Containing Products.

Ephedra plants generally contain ephedrine alkaloids, which are the critical precursor compounds of methamphetamine (METH). METH could cause serious physical and mental damage, and therefore Ephedra materials are strictly in supervision internationally. However, unlawful utilization of Ephedra herbs and its products still exist. Thus, it is imperative to establish a universal method for monitoring Ephedra ingredients in complex mixtures and processed products. In this study, 224 ITS2 sequences representing 59 taxa within Ephedra were collected, and a 23-bp genus-level nucleotide signature (GTCCGGTCCGCCTCGGCGGTGCG) was developed for the identification of the whole genus. The specific primers MH-1F/1R were designed, and 125 individuals of twelve Ephedra species/varieties were gathered for applicability verification of the nucleotide signature. Additionally, seven batches of Chinese patent medicines containing Ephedra herbs were used to test the application of the nucleotide signature in complex and highly processed materials. The results demonstrated that the 23-bp molecular marker was unique to Ephedra and conserved within the genus. It can be successfully utilized for the detection of Ephedra components in complex preparations and processed products with severe DNA degradation. The method developed in this study could undoubtedly serve as a strong support for the supervision of illegal circulation of Ephedra-containing products.

Localization of Major Ephedra Alkaloids in Whole Aerial Parts of Ephedrae Herba Using Direct Analysis in Real Time-Time of Flight-Mass Spectrometry.

Mass spectrometry-based molecular imaging has been utilized to map the spatial distribution of target metabolites in various matrixes. Among the diverse mass spectrometry techniques, matrix-assisted laser desorption/ionization-mass spectrometry (MALDI-MS) is the most popular for molecular imaging due to its powerful spatial resolution. This unparalleled high resolution, however, can paradoxically act as a bottleneck when the bio-imaging of large areas, such as a whole plant, is required. To address this issue and provide a more versatile tool for large scale bio-imaging, direct analysis in real-time-time of flight-mass spectrometry (DART-TOF-MS), an ambient ionization MS, was applied to whole plant bio-imaging of a medicinal plant, Ephedrae Herba. The whole aerial part of the plant was cut into 10-20 cm long pieces, and each part was further cut longitudinally to compare the contents of major ephedra alkaloids between the outer surface and inner part of the stem. Using optimized DART-TOF-MS conditions, molecular imaging of major ephedra alkaloids of the whole aerial part of a single plant was successfully achieved. The concentration of alkaloids analyzed in this study was found to be higher on the inner section than the outer surface of stems. Moreover, side branches, which are used in traditional medicine, represented a far higher concentration of alkaloids than the main stem. In terms of the spatial metabolic distribution, the contents of alkaloids gradually decreased towards the end of branch tips. In this study, a fast and simple macro-scale MS imaging of the whole plant was successfully developed using DART-TOF-MS. This application on the localization of secondary metabolites in whole plants can provide an area of new research using ambient ionization mass spectroscopy and an unprecedented macro-scale view of the biosynthesis and distribution of active components in medicinal plants.

Nutritive value and ruminal degradation of seven Chinese herbs as forage for Tan sheep.

Tan sheep is an indigenous ovine breed of China known for its high meat quality and pleasing taste. Seven herbs of traditional Chinese medicine, namely, Ephedra sinica, Glycyrrhiza uralensis, Caragana korshinskii, Allium mongolicum, Thymus vulgaris, Astragalus membranaceus, and Lespedeza bicolor are commonly grazed by Tan sheep. It has been widely believed that these herbs are of high nutritive value, which may significantly contribute to the high meat quality and distinct flavor of Tan sheep. However, the nutritive values of these herbs have not been evaluated to date. In this study, samples of the seven herbs were collected from the steppe of Yanchi County of Ningxia Autonomous Region of China. The dry matter (DM), crude protein (CP), ether extract (EE), ash (Ash), calcium (Ca), phosphorus (P), neutral detergent fiber (NDF), and acid detergent fiber (ADF) of these herbs were measured using locally cultivated alfalfa as the standard forage. Digestion of the dry matter, neutral detergent fiber, acid detergent fiber, and crude protein in the rumen of Tan sheep was examined using the nylon bag method, in order to evaluate their feeding nutritional value. Our results show that all the seven herbs meet the nutritional needs of ruminants based on the standard forage alfalfa. However, Ephedra, Glycyrrhiza, Caragana, Allium, Astragalus, and Lespedeza have higher nutritive value than Thymus (P < 0.05). According to the ruminal degradation rates of dry matter, neutral detergent fiber, acid detergent fiber, and crude protein, the nutritive value of Caragana, Allium, and Lespedeza is higher than that of Ephedra, Glycyrrhiza, Astragalus, and Thymus (P < 0.05). The overall nutritive value of Allium is the highest among the seven herbs and therefore Allium is recommended to better meet the nutritional needs of Tan sheep.

A network pharmacology-based strategy for predicting anti-inflammatory targets of ephedra in treating asthma.

Asthma, the most common chronic respiratory disease in the world, is involved in a sustained inflammatory response caused by a variety of immune cells. Ephedra with multi-target, multi-pathway functions is an effective treatment for asthma. However, the ingredients and anti-inflammatory targets of ephedra in treating asthma are unclear. Therefore, there is a need for further research. Ephedra-related and anti-inflammatory targets were found and then combined to get intersection, which represented potential anti-inflammatory targets of ephedra. Moreover, compound-anti-inflammatory target and asthma-target protein-protein interaction network were merged to get the protein-protein interaction network intersection and core genes in asthma-target protein-protein interaction network. For the anti-inflammatory targets of ephedra in treating asthma, Gene Ontology and pathway analysis were executed to confirm gene functions of ephedra in antagonizing inflammation of asthma. Finally, molecular docking, qRT-PCR, WB and ELISA were performed to assess the binding activities between the compounds and anti-inflammatory targets of ephedra in treating asthma. Critical compounds and anti-inflammatory targets of ephedra in treating asthma were identified, including quercetin, luteolin, kempferol, naringenin, beta-sitosterol, SELE, IL-2 and CXCL10. The biological processes of anti-inflammatory targets of ephedra in treating asthma were involved in immune response, inflammatory response, cell-cell signaling and response to lipopolysaccharide. Moreover, 22 pathways were obtained and we proved that critical compounds inhabited the expression of SELE, IL-2 and CXCL10 at mRNA and protein levels.

Phytochemical Analysis, Ephedra Procera C. A. Mey. Mediated Green Synthesis of Silver Nanoparticles, Their Cytotoxic and Antimicrobial Potentials.

Background and Objectives: The current study focuses on an eco-friendly and cost-effective method of Ephedra procera C. A. Mey. mediated green synthesis of silver nanoparticles as potential cytotoxic, antimicrobial and anti-oxidant agents. Materials and Methods: Plant aqueous extracts were screened for Total Phenolic (TPC), Total Flavonoid contents (TFC), Total Antioxidant Capacity (TAC) and 2,2-diphenyl-1-picrylhydrazyl (DPPH) free radical scavenging potentials. Total reducing power estimated by potassium ferricyanide colorimetric assay. The biosynthesized E. procera nanoparticles (EpNPs) were characterized by UV-spectroscopy, Fourier-transform infrared spectroscopy (FTIR), X-ray diffraction and Scanning electron microscopy. EpNPs were evaluated for their antimicrobial, bio-compatibility and cytotoxic potentials. Results: Initial phytocheimcal analysis of plant aqueous extract revealed TFC of 20.7 ± 0.21 µg/mg extract and TPC of 117.01 ± 0.78 µg/mg extract. TAC, DPPH free radical scavenging and reducing power were 73.8 ± 0.32 µg/mg extract, 71.8 ± 0.73% and 105.4 ± 0.65 µg/mg extract respectively. The synthesized EpNPs were observed to possess high cytotoxicity against HepG2 cancer cell lines with IC50 (61.3 µg/mL) as compared aqueous extract with IC50 of (247 µg/mL). EpNPs were found to be biocompatible and have less effect on human erythrocytes. EpNPs exhibited significant antioxidant potentials and exhibited considerable activity against Escherichia coli and Bacillus subtilis with Minimum Inhibitory Concentration (MICs) of 11.12 µg/mL and 11.33 µg/mL respectively. Fungal species Aspergillus niger and Aspergillus flavus were found susceptible to EpNPs. Conclusions: Results of the current study revealed that EpNPs exhibited considerable antibacterial, antifungal and cytotoxic potentials. Aqueous extract possesses significant anti-radical properties and thus can be useful in free radicals induced degenerative disorders.

Discrimination of three Ephedra species and their geographical origins based on multi-element fingerprinting by inductively coupled plasma mass spectrometry.

Discrimination of species and geographical origins of traditional Chinese medicine (TCM) is essential to prevent adulteration and inferior problems. We studied Ephedra sinica Stapf, Ephedra intermedia Schrenk et C.A.Mey. and Ephedra przewalskii Bge. to investigate the relationship between inorganic element content and these three species and their geographical origins. 38 elemental fingerprints from six major Ephedra-producing regions, namely, Inner Mongolia, Ningxia, Gansu, Shanxi, Shaanxi, and Sinkiang, were determined to evaluate the importance of inorganic elements to three species and their geographical origins. The contents of 15 elements, namely, N, P, K, S, Ca, Mg, Fe, Mn, Na, Cl, Sr, Cu, Zn, B, and Mo, of Ephedra samples were measured using inductively coupled plasma mass spectroscopy. Elemental contents were used as chemical indicators to classify species and origins of Ephedra samples using a radar plot and multivariate data analysis, including hierarchical cluster analysis (HCA), principal component analysis (PCA), and discriminant analysis (DA). Ephedra samples from different species and geographical origins could be differentiated. This study showed that inorganic elemental fingerprint combined with multivariate statistical analysis is a promising tool for distinguishing three Ephedra species and their geographical origins, and this strategy might be an effective method for authenticity discrimination of TCM.

Ephedra alkaloid contents of Chinese herbal formulae sold in Taiwan.

Consumption of Ephedra alkaloids is prohibited in-competition by the World Anti-Doping Agency (WADA). In Taiwan, colds are often treated with Chinese herbal formulae containing Herba Ephedrae. We screened products sold in Taiwan and preliminarily assessed their relationships with WADA threshold violations. Fifty-six concentrated powder products, including 19 Chinese herbal formulae that contained Herba Ephedrae, were collected. The content of Ephedra alkaloids, namely ephedrine (E), methylephedrine (ME), norpseudoephedrine (NPE; cathine), pseudoephedrine (PE), and norephedrine (NE; phenylpropanolamine), was determined using a validated high-performance liquid chromatography method. The results revealed that the phenotypic indicators of the collected products, E/PE and E/total ratios, were 1.52-4.70 and 0.49-0.72, respectively, indicating that the Herba Ephedrae species in these products was probably E. sinica or E. equisetina, but not E. intermedia. The contents of E, ME, NPE, PE, and NE and the total alkaloid contents in the daily doses of the products were 0.45-34.97, 0.05-4.87, 0.04-3.61, 0.15-12.09, and 0.01-2.00 mg and 0.68-53.64 mg, respectively. The alkaloid contents followed a relatively consistent order (E > PE > ME ≈ NPE > NE), even for products from different manufacturers. We calculated that single doses of 50.0% and 3.6% of the products would result in the WADA thresholds of E and NPE being exceeded, respectively. Our data provide critical information for athletes and medical personnel, who should be wary of using complex Chinese herbal formulae in addition to over-the-counter products.

Ephedrine as a lead compound for the development of new DPP-IV inhibitors.

AIM: Extracts from Ephedra species have been reported to be effective as antidiabetics. A previous in silico study predicted that ephedrine and five ephedrine derivatives could contribute to the described antidiabetic effect of Ephedra extracts by inhibiting dipeptidyl peptidase IV (DPP-IV). Finding selective DPP-IV inhibitors is a current therapeutic strategy for Type 2 diabetes mellitus management. Therefore, the main aim of this work is to experimentally determine whether these alkaloids are DPP-IV inhibitors. Materials & methods: The DPP-IV inhibition of Ephedra's alkaloids was determined via a competitive-binding assay. Then, computational analyses were used in order to find out the protein-ligand interactions and to perform a lead optimization. RESULTS: Our results show that all six molecules are DPP-IV inhibitors, with IC50 ranging from 124 µM for ephedrine to 28 mM for N-methylpseudoephedrine. CONCLUSION: Further computational analysis shows how Ephedra's alkaloids could be used as promising lead molecules for designing more potent and selective DPP-IV inhibitors.

Antiviral effects of Yinhuapinggan granule against influenza virus infection in the ICR mice model.

Yinhuapinggan granule (YHPG), a Chinese medicine granule based on Ma-Huang-Tang (Ephedra Decoction) and the clinical experience of Professor Wan Haitong, is used in traditional Chinese medicine (TCM) for the treatment of colds, influenza, fever, inflammation and cough. This study investigated the antiviral effects of YHPG on the production of inflammatory cytokines in influenza virus (IFV)-infected mice and evaluated the effect of YHPG on the expression of NF-κB p65 and the level of key signaling molecules in the TLR4 signaling pathway. ICR mice were orally administrated YHPG at doses of 7.5, 15 and 30 g kg(-1) day(-1) for 2 or 6 days after IFV infection. On days 3 and 7 after infection, YHPG (15 g/kg and 30 g/kg) significantly increased levels of interleukin (IL)-2 and interferon gamma and decreased levels of IL-4, IL-5 and tumor necrosis factor (TNF) in serum compared with the IFV control group. Furthermore, the expression of TLR4, MyD88, TRAF6 and NF-κB p65 at the mRNA and protein level was significantly lower in the YHPG (15 and 30 g/kg) treatment groups than in the IFV control group. These results suggest that YHPG has antiviral effects in IFV-infected mice, which is associated with the inhibition of the TLR4-MyD88-TRAF6 signaling pathway and the expression of NF-κB p65.

Benzaldehyde is a precursor of phenylpropylamino alkaloids as revealed by targeted metabolic profiling and comparative biochemical analyses in Ephedra spp.

Ephedrine and pseudoephedrine are phenylpropylamino alkaloids widely used in modern medicine. Some Ephedra species such as E. sinica Stapf (Ephedraceae), a widely used Chinese medicinal plant (Chinese name: Ma Huang), accumulate ephedrine alkaloids as active constituents. Other Ephedra species, such as E. foeminea Forssk. (syn. E. campylopoda C.A. Mey) lack ephedrine alkaloids and their postulated metabolic precursors 1-phenylpropane-1,2-dione and (S)-cathinone. Solid-phase microextraction analysis of freshly picked young E. sinica and E. foeminea stems revealed the presence of increased benzaldehyde levels in E. foeminea, whereas 1-phenylpropane-1,2-dione was detected only in E. sinica. Soluble protein preparations from E. sinica and E. foeminea stems catalyzed the conversion of benzaldehyde and pyruvate to (R)-phenylacetylcarbinol, (S)-phenylacetylcarbinol, (R)-2-hydroxypropiophenone (S)-2-hydroxypropiophenone and 1-phenylpropane-1,2-dione. The activity, termed benzaldehyde carboxyligase (BCL) required the presence of magnesium and thiamine pyrophosphate and was 40 times higher in E. sinica as compared to E. foeminea. The distribution patterns of BCL activity in E. sinica tissues correlates well with the distribution pattern of the ephedrine alkaloids. (S)-Cathinone reductase enzymatic activities generating (1R,2S)-norephedrine and (1S,1R)-norephedrine were significantly higher in E. sinica relative to the levels displayed by E. foeminea. Surprisingly, (1R,2S)-norephedrine N-methyltransferase activity which is a downstream enzyme in ephedrine biosynthesis was significantly higher in E. foeminea than in E. sinica. Our studies further support that benzaldehyde is the metabolic precursor to phenylpropylamino alkaloids in E. sinica.

Capillary electrophoresis of phytochemical substances in herbal drugs and medicinal plants.

This paper reviews the applications of electromigration methods in analysis of phytochemical substances in herbal drugs and medicinal plants. A short description of the basic principles of capillary electrophoretic techniques is firstly given, then the overview deals with the applications of selected methods published in the period 2005-2010. The phytochemical substances have been classified according to their chemical nature (e.g. alkaloids, polyphenols, carbohydrates, lipids, terpenes) and the applied CE approaches, namely CZE, NACE, MEKC, MEEKC and CEC, together with the different detection methods, are critically discussed for each of the considered classes of natural compounds.

Perioperative risks and benefits of herbal supplements in aesthetic surgery.

Most medications, herbal preparations, and nutraceutical supplements have notable effects on biochemical pathways and may influence wound healing, coagulation, and cardiovascular function. They can also interact with other drugs. A large portion of the data available regarding the effects of naturopathic medicines is anecdotal. Marketing of certain products may be misleading and potentially harmful, and quality control standards are highly variable. In order to ensure quality control and standardization of products, it is prudent to work with preparations manufactured by companies that adhere to pharmaceutical (good manufacturing practice [GMP]) standards. However, many of these higher-quality products are not readily available to the public over the counter. A large percentage of patients undergoing plastic surgery use one or more herbal medications, but the disclosure of such medications to allopathic providers is often incomplete. In addition, patients may not understand the importance of discontinuing such medications before surgery. The authors review research on the possible benefits and risks of commonly used herbal medications such as arnica montana, St. John's wort, bromelain, echinacea, ginkgo biloba, ephedra, valerian, and others, focusing on their potentially positive or negative impact during the perioperative period of aesthetic surgery. Good communication with surgical patients, including the administration of a presurgical questionnaire to help identify any use of herbal medications, is emphasized.

Metabolome analysis of Ephedra plants with different contents of ephedrine alkaloids by using UPLC-Q-TOF-MS.

Metabolome analysis of four varieties of Ephedra plants, which contain different amounts of ephedrine alkaloids, was demonstrated in this study. The metabolites were comprehensively analyzed by using ultra performance liquid chromatography (UPLC) coupled with quadrupole time-of-flight mass spectrometry (Q-TOF-MS) and the ephedrine alkaloids were also profiled. Subsequently, multivariate analyses of principal component analysis (PCA) and batch-learning self-organizing mapping (BL-SOM) analysis were applied to the raw data of the total ion chromatogram (TIC). PCA was performed to visualize the fingerprints characteristic for each Ephedra variant and the independent metabolome clusters were formed. The metabolite fingerprints were also visualized by BL-SOM analysis and were displayed as a lattice of colored individual cells which was characteristic for each Ephedra variant. BL-SOM analysis was also used for identification of chemical marker peaks because the information assigned to a cell represented either increases or decreases in peak intensities. Using this analysis, ephedrine alkaloids were successfully selected from the TICs as chemical markers for each Ephedra variant and this result suggested that BL-SOM analysis was an effective method for the selection of marker metabolites. We report our study here as a practical case of metabolomic study on medicinal resources.

Metabolic fingerprinting of Ephedra species using 1H-NMR spectroscopy and principal component analysis.

The metabolomic analysis of Ephedra species was performed using 1H-NMR spectroscopy and multivariate data analysis. A broad range of metabolites could be detected by 1H-NMR spectroscopy without any chromatographic separation. The principal component analysis used to reduce the huge data set obtained from the 1H-NMR spectra of the plant extracts clearly discriminated three different Ephedra species. The major differences in Ephedra sinica, Ephedra intermedia and Ephedra distachya var. distachya were found to be due to benzoic acid analogues in the aqueous fraction and ephedrine-type alkaloids in the organic fraction. Based on this metabolomic recognition, one of nine commercial Ephedra materials evaluated was shown to be a mixture of Ephedra species. This method will be a useful tool for chemotaxonomic analysis and authentification of Ephedra species including quality control of plant materials.

Single-step recovery of ephedrine hydrochloride from raw materials using expanded bed adsorption.

Expanded bed adsorption, using a cation resin 001 x 7 Styrene-DVB, was used to recover and purify ephedrine hydrochloride from a powdered herb. The axial liquid-phase dispersion coefficient was about 10(-5) m(2) s(-1) and the recovery yield and purification reached 86% and 22, respectively. Compared with using conventional extraction with dimethylbenzene, this method is safer and also more efficient.